Molecular cloning of candidate antigens recognized by anti-endothelial cell antibodies

Anti-endothelial cell antibodies (AECA) have been reported in such a vast array of conditions associated with vasculitis that the related autoantigens have become extremely difficult to identify. We have, therefore, used a molecular cloning approach to define endothelial cell (EC) target structures by screening a human umbilical vein EC (HUVEC) cDNA expression library. Total RNA was extracted from HUVECs and purified by oligo-dT cellulose chromatography. A commercial kit was used to synthesize cDNA which was inserted into the EcoRI/XhoI-digested and dephosphorylated lambda ZAP Express vector. The construct was incorporated into phages and transformed with E. coli strain XL1 Blue. After the addition of AECAs, positive clones were isolated in suspending medium, purified and incorporated again into the XL1. The insert-containing phagemids were exised from recombinant phages and introduced into E. coli XLOLR strain. The restriction fragments, obtained from the cDNA inserts by EcoRI endonuclease digestion, were sequenced by the dideoxy-chain termination method with two primers, T3 (AATTAACCCTCACTAAAGGG) and T7 (CGGGATATCACTCAGCATAATG). The sequences were examined for analogy in the GenBank and EBML nucleic acid data banks. Two sera, one from a patient with systemic lupus erythematosus (SLE) and another from a patient with Wegener's granulomatosis (WG), both strongly AECA-positive in our in-house cell-ELISA, were used to screen the bank. The SLE serum recognized methyltransferase, NADH dehydrogenase and unidentified components, whereas the WG serum recognized methyltransferase, GAPDH and unidentified structures. AECAs could thus be associated with a bulk of autoantibodies targeting various enzymes, or get inside the ECs to bind to such proteins.