Skip to main content

Table 1 PCR primers and Southern blot probes

From: Patients with systemic lupus erythematosus have abnormally elevated Epstein–Barr virus load in blood

Gene Primers and probes Sequence (5'-3') Expected product size PCR conditions
EBNA-3C Forward primer AGAAGGGGAGCGTGTGTTGT Type 1: 153 bp
Type 2: 246 bp
94°, 30 s
61°, 60 s
72°, 60 s
  Reverse primer GGCTCGTTTTTGACGTCGGC   
  Probe TCATAGAGGTGATTGATGTT   
EBNA-2 Forward primer AGGCTGCCCACCCTGAGGAT Type 1: 168 bp
Type 2: 184 bp
94°, 30 s
64°, 45 s
72°, 30 s
  Reverse primer GCCACCTGGCAGCCCTAAAG   
EBNA-3B Forward primer CCCTTGCGGATGCAGCCAAT Type 1: 125 bp
Type 2: 149 bp
94°, 30 s
62°, 60 s
72°, 60 s
  Reverse primer GGCTGATATGGAATGTGCCC   
  1. EBNA, Epstein–Barr virus nuclear antigen.