Skip to main content

Table 2 Sequences of the gene-specific oligonucleotide primers and probes for real-time reverse transcriptase polymerase chain reaction

From: Expression analysis of three isoforms of hyaluronan synthase and hyaluronidase in the synovium of knees in osteoarthritis and rheumatoid arthritis by quantitative real-time reverse transcriptase polymerase chain reaction

Primer and probe Sequence Position
HAS-1 855F GACTCCTGGGTCAGCTTCCTAAG 855 – 877
  995R AAACTGCTGCAAGAGGTTATTCCT 995 – 972
  probe TATCCTGCATCAGCGGTCCTCTAGGC 940 – 965
HAS-2 20F CTATGCTTGACCCAGCCTCATC 20 – 41
  149R ACACTGCTGAGGAATGAGATCCA 149 – 127
  MGB probea AGATGTCCAGATTTTA 96 – 111
HAS-3 888F TGTCCAGATCCTCAACAAGTACGA 888 – 911
  1005R AATACACTGCACACAGCCAAAGTAG 1005 – 981
  probe TCATGGATTTCCTTCCTGAGCAGCGT 913 – 938
HYAL-1 1561F AGTGGTGCTCTGGGTGAGCT 1561 – 1580
  1667R TGGTCACGTTCAGGATGAAGG 1667 – 1647
  probe CCAAGGAATCATGTCAGGCCATCAAGG 1596 – 1622
HYAL-2 1069F CGCAGCTGGTGTCATCCTCT 1069 – 1088
  1159R CAGCAGCCGTGTCAGGTAATC 1159 – 1139
  probe TACACCACAAGCACGGAGACCTGCC 1103 – 1127
HYAL-3 1130F GCCTCACACACCGGAGATCT 1130 – 1149
  1202R GCTGCACTCACACCAATGGA 1202 – 1183
  probe TCCTGTCCCAGGATGACCTTGTGCA 1157 – 1181
  1. aMinor groove binder (MGB) enhances the melting temperature of the probe (see Materials and methods). HAS, hyaluronan synthase; HYAL, hyaluronidase.