Skip to main content

Table 1 Sequences of primers and probes for quantitative real-time polymerase chain reaction

From: Repression of anti-proliferative factor Tob1in osteoarthritic cartilage

Gene GenBank accession no. Primers (5'→3') Conc. (nM) Probe (5'→3') MgCl2 (mM)
GAPDH NM_002046 Forward: GAAGGTGAAGGTCGGAGTC 50 CAAGCTTCCCGTTCTCAGCC 5.5
   Reverse: GAAGATGGTGATGGGATTTC 900   
TOB1 NM_005749 Forward: TCTGCTGCTGTAAGCCCTACCT 300 CGGTCCACTCAGCCTTTAACCTTTACCACT 6.5
   Reverse: TTCATTTTGGTAGAGCCGAACTT 900   
Ki-67 NM_002417 Forward: CAGTGATCAACGCCGTAGGTC 900 CTTCCAGCAGCAAATCTCAGACAGAGGTTC 6.0
   Reverse: TCGGCTGATAGACACTCTCTTTTG 900   
COL2A1 NM_001844 Forward:CAACACTGCCAACGTCCAGAT 50 ACCTTCCTACGCCTGCTGTCCACG 5.5
   Reverse: CTGCTTCGTCCAGATAGGCAAT 300   
MMP-13 NM_002427 Forward: TCCTCTTCTTGAGCTGGACTCATT 900 TCCTCAGACAAATCATCTTCATCACCACCAC 7.0
   Reverse: CGCTCTGCAAACTGGAGGTC 50   
  1. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMP, matrix metalloproteinase; COL2A1, collagen type II (alpha 1 chain); TOB1, Transducer of ERBB2.