Skip to main content

Table 1 PCR primers and sequence start position for amplification of MT-ND1 and DLD

From: Somatic mutations in the mitochondria of rheumatoid arthritis synoviocytes

Primer name Start position Sequence 5'-3'
mtMT-ND1a   
   F1A 2995 TTGGATCAGGACATCCCGA
   R1A 3645 ACGGCTAGGCTAGAGGTGG
   F1B 3536 TTAGCTCTCACCATCGCT
   R1B 4239 ATTGTAATGGGTATGGAGACA
   F2 4184 TTCCTACCACTCACCCTAG
   R2 4869 CATGTGAGAAGAAGCAG
DLD b   
   DLD – sense 417 ATGATGGAGCAGAAGAGTACTGCA
   DLD – antisense 1088 TTTAGTTTGAAATCTGGTATTGAC
  1. aSee Fig. 1 for position of primers. Both forward and reverse primers in addition to the specific nucleotide sequence have a corresponding M13 tag (M13F, 5'-TGTAAAACGACGGCCAGT- 3' ; M13R, 5'-CAGGAAACAGCTATGACC-3'); start position numbering represents location of 5' end corresponding to the Anderson Reference Sequence [17]. bStart position numbering represents location of the 5' end and corresponds to the DLD cDNA numbering system published by Pons and colleagues [19]. mt, mitochondrial.