Skip to main content

Table 1 Primers used for RT-PCR

From: Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis

Gene Annealing temperature (°C) Product size (base pairs) Sequence (5' to 3') GenBank accession number
Collagen II 65 141 F ACGGTGGACGAGGTCTGACT
R GGCCTGTCTCTCCACGTTCA
AF138883
Aggrecan 65 375 F CCGCTATGACGCCATCTGCT
R TGCACGACGAGGTCCTCACT
AF019758
Decorin 55 319 F CAAACTCTTTTGCTTGGGCT
R CACTGGACAACTCGCAGATG
AF125041
Biglycan 65 204 F CCATGCTGAACGATGAGGAA
R CATTATTCTGCAGGTCCAGC
AF034842
Fibromodulin 65 442 F CTGGACCACAACAACCTGAC
R GGATCTTCTGCAGCTGGTTG
AF020291
Lumican 65 284 F CAGCCATGTACTGCGATGAG
R CTGCAGGTCCACCAGAGATT
NM173934
TGF-β 60 271 F CGGCAGCTGTACATTGACTT
R AGCGCACGATCATGTTGGAC
AF000133
CTGF 65 504 F TCTTCTGCGACTTCGGCTCC
R CCTCCAGGTCAGCTTCGCAA
NM174030
Collagen I 65 460 F CCACCAGTCACCTGCGTACA
R GGAGACCACGAGGACCAGAA
AF129287
Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTG
R GTGGGGAAACTGCACAACAT
L47641
GAPDH 55 320 F TCACCATCTTCCAGGAGCGA
R GGCGTGGACAGTGGTCATAA
AF035421
  1. Shown are the details of the primers used for RT-PCR, including annealing temperatures, size of the amplified products, forward (F) and reverse (R) sequences, and primer source. CTCG, connective tissue growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TGF, transforming growth factor.