Skip to main content

Table 2 Sequences of PCR primers and probes

From: Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis

  Primer (5'-3') Probe
c-Jun fw: TGCATGCTATCATTGGCTCATAC CCCGGCAACACACA-MGB
  rv: CACACCATCTTCTGGTGTACAGTCT  
HIF-1α fw:CTATGGAGGCCAGAAGAGGGTAT AGATCCCTTGAAGCTAG-MGB
  rv:CCCACATCAGGTGGCTCATAA  
Glucose transporter-1 fw:GGGCATGTGCTTCCAGTATGT CAACTGTGCGGCCCCTACGTCTTC
  rv:ACGAGGAGCACCGTGAAGAT  
  1. fw, forward; rv, reverse