Skip to main content

Advertisement

Table 1 Primer sets used for quantitative PCR study

From: Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice

Gene Forward primer Reverse primer
IL-1β AACCTGCTGGTGTGTGACGTTC CAGCACGAGGCTTTTTTGTTGT
TNF-α CTACTCCCAGGTTCTCTTCAA GCAGAGAGGAGGTTGACTTTC
IL-6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG
MCP-1 CCACTCACCTGCTGCTACTCAT TGGTGATCCTCTTGTAGCCCTCC
Ccl5 GTCGTGTTTGTCACTCGAAGGA TTGATGTATTCTTGAACCCACTTCTT
iNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTCG
COX-2 GTGGAAAAACCTCGTCCAGA GCTCGGCTTCCAGTATTGAG
β-Actin AGGTCATCACTATTGGCAACGA CACTTCATGATGGAATTGAATGTAGTT