Skip to main content

Table 1 Probes and primer sequences used

From: Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation

Gene Primers and probes
11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG
  Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC
  Probe: CATGCTCATTCTCAACCACATCACCAACA
H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC
  Reverse primer: GTAGCCCACTCTCTCGTCCAA
  Probe: AAGGCACGCCCTCCCAGCG
GRα Forward primer: GCGATGGTCTCAGAAACCAAAC
  Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC
  Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA
GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT
  Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA
  Probe: TGT GTG AGA TGT GCT TTC TGG TT
C/EBPα Forward primer: TGGACAAGAACAGCAACGAG
  Reverse primer: TTGTCACTGGTCAGCTCCAG
  Probe: CACCTTCTGCTGCGTCTCCACGTT
C/EBPβ Forward primer: GACAAGCACAGCGACGAGTA
  Reverse primer: GTGCTGCGTCTCCAGGTT
  Probe: ATCTTGGCCTTGTCGCGGCTCTT
IL-6 Assay on demand Hs00174131_m1 (ABI)
  1. 11β-HSD1, 11β-hydroxysteroid dehydrogenase type 1; C/EBP, CCAAT/enhancer binding protein; GR, glucocorticoid receptor; H6PDH, hexose-6-phosphate dehydrogenase.