Skip to main content

Advertisement

Table 1 Bovine metalloproteinase and inhibitor primers for real-time polymerase chain reaction

From: Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis

Gene Sequence (5'-3') Length (bp)
MMP-1 GATGCCGCTGTTTCTGAGGA 372
  GACTGAGCGACTAACACGACACAT  
MMP-2 TCTGCCCCCATGAAGCCCTGTT 347
  GCCCCACTTGCGGTCATCATCGTA  
MMP-3 TTAGAGAACATGGGGACTTTTTG 360
  CGGGTTCGGGAGGCACAG  
MMP-8 ATGCTGCTTATGAGGATTTTGACA 101
  GCCTGGGGTAACCTTGCTGAGTA  
MMP-9 CGCCACCACCGCCAACTACG 350
  GGGGGTGCTCCTCTGTGAATCTGT  
MMP-12 TGTGACCCCAATATGAGTTTT 155
  TTGAATGTAAGACGGTAGGTTT  
MMP-13 CCCTCTGGTCTGTTGGCTCAC 304
  CTGGCGTTTTGGGATGTTTAGA  
MMP-14 AGGCCGACATCATGATCTTCTTTG 375
  CTGGGTTGAGGGGGCATCTTAGTG  
MMP-16 ACCCCAGGATGTCAGTGC 287
  AATAGCTTTACGGGTTTCAGG  
TIMP-1 TGGGCACCTGCACATCACC 277
  CATCTGGGCCCGCAAGGACTG  
TIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277
  TGTCCCAGGGCACGATGAAGTC  
TIMP-3 GATGTACCGAGGATTCACCAAGAT 356
  GCCGGATGCAAGCGTAGT  
TIMP-4 ATATTTATACGCCTTTTGATTCCT 297
  GGTACCCGTAGAGCTTCCGTTCC  
α2M GCCCGCTTTGCCCCTAACA 359
  TCGTCCACCCCACCCTTGATG  
RECK GTAATTGCCAAAAAGTGAAA 352
  TAGGTGCATATAAACAAGAAGTA  
ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264
  CATCATGGGGCATGTTAAACAC  
ADAMTS-4 GCGCCCGCTTCATCACTG 101
  TTGCCGGGGAAGGTCACG  
ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196
  TGGGTTATTGCAGTGGCGGTAGG  
ADAMTS-8 AGATCTTTGGGCTGGGCTTCC 116
  GGCTGGCATTCCTCGTGTGG  
ADAMTS-9 GGGAGCGGAAACGAAAACCTATT 167
  CACTGGGCACTACATTCACTCCTG  
ADAMTS-15 GACACGGCCATCCTCTTCACTCG 107
  AGCAGCTCCTCTTGGGGTCACAC  
  1. ADAMTS, a disintegrin and metalloproteinase domain with thrombospondin motifs; α2M, alpha 2 macroglobulin; MMP, matrix metalloproteinase; RECK, reversion-inducing cysteine-rich protein with Kazal motifs; TIMP, tissue inhibitor of metalloproteinase.