Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 A list of primer and probe sequences for the genes evaluated

From: Analysis of normal and osteoarthritic canine cartilage mRNA expression by quantitative polymerase chain reaction

Gene Forward Reverse Probe
ADAMTS5 TGGGTTCCCAAATATGCAG CTGTCCCATCCGTCACCT CTGGGAGA
1AGC1 GGGACCTGTGTGAGATCGAC GTAACAGTGGCCCTGGAACT AGGAGCTG
BGN CAGAACAACGACATCTCAGAGC TCACCAGGACGAGAGCGTA CTCCACCA
COL1A2 CTATCAATGGTGGTACCCAGTTT TGTTTTGAGAGGCATGGTTG GCCTGCTG
COL2A1 CTGGTGAACCTGGACGAGAG ACCACGATCACCCTTGACTC CCTCCTGG
COL3A1 GGATGGTGGCTTCCAGTTT CCAGCTGGACATCGAGGA GCTGCCTG
COL5A1 AACCTGTCGGATGGCAAGT CAGTCCAAGATCAAGGTGACAT CAGCATCC
COL9A3 CGAGGTGCCTCAGGTGAC ACCCAGCTCTCCTTTGTCC GAGACCAG
CSPG2 TGGATGGTTTTAATACGTTCAGG GCCGTAGTCACACGTCTCTG CTGCCTTC
CTSB CGGCCTTCACCGTGTACT GTGACGTGCTGGTACACTCC CTTCCTGC
CTSD GGTCCACATGGAGCAGGT TATGAGGGAGGTGCCTGTGT TGGGCAGC
DCN CGCTGTCAGTGCCATCTC GGGGGAAGATCTTTTGGTACTT TCCAGTGT
GAPDH CTGGGGCTCACTTGAAAGG CAAACATGGGGGCATCAG CTGCTCCT
Genomic AACCCTCAAAGATGAGGTTTAGC ACTCTGGGATCACGCATGT CTGCCTTC
LUM ACCTGGAAATTCTTTTAATGTATCATC CGGTATGTTTTTAAGCTTATTGTAGGA TGCTGGAG
MMP13 CCGCGACCTTATCTTCATCT AACCTTCCAGAATGTCATAACCA AGAGGCAG
RPL13A CTGCCCCACAAGACCAAG GGGATCCCATCAAACACCT CCAGGCTG
SDHA GGTGGCACTTCTACGACACC ATGTAGTGGATGGCGTCCTG CTGGCTGG
TBP TCCACAGCCTATCCAGAACA CTGCTGCTGTTGTCTCTGCT CTGGAGGA
TIMP1 TGCATCCTGCTGTTGCTG AACTTGGCCCTGATGACG CCCAGCAG
TIMP2 ATGGGCTGTGAGTGCAAGAT CACTCATCCGGAGACGAGAT CTGCCCCA
TIMP4 GCAGAGAGAAAGTCTGAATCATCA GGCACTGTATAGCAGGTGGTAA TGTGGCTG
TNC TGGATGGGACAGTCAAGGA GCTCAGCTCTGCCAGGTTA CCACCTCC
VIM TACAGGAAGCTGCTGGAAGG CCTCAGGTTCAGGGAAGAAA GAGCAGGA
  1. ADAMTS5, ADAM metallopeptidase with thrombospondin type 1 motif, 5; AGC1, aggrecan; BGN, biglycan; COL1A2, type I collagen, alpha two chain; COL2A1, type II collagen alpha 1 chain; COL3A1, type III collagen alpha 1 chain; COL5A1, type V collagen alpha 1 chain; COL9A3, type IX collagen alpha 3 chain; CSPG2, chondroitin sulphate proteoglycan 2; CTSB, cathepsin B; CTSD, cathepsin D; DCN, decorin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Genomic, Genomic DNA, LUM, lumican;MMP13, matrix metalloproteinase 13; RPL13A, ribosomal protein L13a; SDHA, succinate dehydrogenase complex, subunit A; TBP, TATA box binding protein; TIMP1, tissue inhibitor of metalloproteinase 1; TIMP2, tissue inhibitor of metalloproteinase 2; TIMP4, tissue inhibitor of metalloproteinase 4; TNC, Tenascin C; VIM, vimentin.