Skip to main content

Table 1 Primer sequences used to quantify gene expression with real-time PCR

From: Exogenous glucosamine globally protects chondrocytes from the arthritogenic effects of IL-1β

Gene Sequence (5' to 3')
Cartilage link protein Forward, GCATCAAGTGGACCAAGCTA
  Reverse, GTAACTCCAATGCCACCACA
Collagen alpha 1 type II Forward, GTGGAGCAGCAAGAGCAAGGA
  Reverse, CTTGCCCCACTTACCAGTGTG
CXCL5 (LIX) Forward, CACCCTGCTGGCATTTCTG
  Reverse, AACCATGGCCGAGAAAGGA
MMP-3 Forward, CTGGAATGGTCTTGGCTCAT
  Reverse, CTGACTGCATCGAAGGACAA
MMP-9 Forward, CCACCGAGCTATCCACTCAT
  Reverse, GTCCGGTTTCAGCATGTTTT
MMP-12 Forward, TGCAGCTGTCTTTGATCCAC
  Reverse, TCCAATTGGTAGGCTCCTTG
TIMP-3 Forward, GTACACAGGGCTGTGCAACTTTGTG
  Reverse, CTTCTGCCGGATGCAGGCGTAGTG
EF1alpha Forward, GATGGCCCCAAATTCTTGAAG
  Reverse, GGACCATGTCAACAATGGCAG