Skip to main content

Table 3 Comparison of the fold changes between species-specific microarray analysis and real-time RT-PCR performed on fibroblast-like synovial cells exposed to lipopolysaccharide

From: Effects of hyaluronan treatment on lipopolysaccharide-challenged fibroblast-like synovial cells

  Fold change after 100 ng/ml lipopolysaccharide challenge Fold change after 1,000 ng/ml lipopolysaccharide challenge Real-time RT-PCR primer
  Microarray analysis Real-time RT-PCR Microarray analysis Real-time RT-PCR  
IL-1α 16 155 34 290 Forward, TTGTGCCAACCAATGAGATCA
      Reverse, TTCATGCTTTGCCTTCTTCTTG
TNFα 5 6 6 10 Forward, GACTTGAAGTTTTCTAAGCGATGCT
      Reverse, GGATCCACTGCCACGTACTTG
Prostaglandin peroxide synthase 3 2 3 4 Forward, GGCCAGTTTTCCTCACCAAA
      Reverse, AAATAAAGCTCTCTGCTTTTCATGAA
  1. The fold changes are normalized to unchallenged fibroblast-like synovial cells.