Skip to main content

Table 1 Primers used for RT-PCR

From: Extracellular localization of galectin-3 has a deleterious role in joint tissues

Amplified gene product Primers Base pairs Reference
ADAMTS-5 S: GGCATCATTCATGTGACAC
AS: GCATCGTAGGTCTGTCCTG
364  
MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCAC
AS: CAGTGTTGGCTGAGTGAAAGAGACCC
284  
Osteocalcin S: CATGAGAGCCCTCACA
AS: AGAGCGACACCCTAGAC
310 [48]
Alkaline phosphatase S: TGCAGTACGAGCTGAACAG
AS: TGAAGACGTGGGAATGGTC
267  
Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGA
AS: CGCCCTGTTCGCCTGTCTCA
252  
18S S: GAATCAGGGTTCGATTCCG
AS: CCAAGATCCAACTACGAGC
279 [29]
  1. S, sense; AS, antisense.