Skip to main content

Table 1 Sequences of PCR primers used

From: Reduction of urate crystal-induced inflammation by root extracts from traditional oriental medicinal plants: elevation of prostaglandin D2levels

Target gene Sequence
GAPDH forward 5'TGCAGTGGCAAAGTGGAGATT3'
GAPDH reverse 5'ATTTGCCGTGAGTGGAGTCAT3'
IL-6 forward 5'GGAGAGGAGACTTCACAG3'
IL-6 reverse 5'GCCATTGCACAACTCTTTTC3'
TNF-α forward 5'CATCTTCTCAAAATTCGAGTGACAA3'
TNF-α reverse 5'TGGGAGTAGACAAGGTACAACCC3'
h-PGDS forward 5'ATCCAAGGCTGGTGACTTTACG3'
h-PGDS reverse 5'TGAAGGCAACATGGATCAGCTA3'
  1. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; h-PGDS, hematopoietic prostaglandin D synthase; IL, interleukin; PCR, polymerase chain reaction; TNF, tumor necrosis factor.