Skip to main content

Advertisement

Table 1 Primer and probe sequences of desired genes

From: Passage and reversal effects on gene expression of bovine meniscal fibrochondrocytes

Target gene (GenBank accession number, product size) Forward primer (5'→3') Reverse primer (5'→3') Probe (5'→3')
Collagen-I (NM-174520, 97 bp) CATTAGGGGTCACAATGGTC TGGAGTTCCATTTTCACCAG ATGGATTTGAAGGGACAGCCTTGG
Collagen-IIa (X02420, 76 bp) AACGGTGGCTTCCACTTC GCAGGAAGGTCATCTGGA ATGACAACCTGGCTCCCAACACC
Aggrecan (U76615, 76 bp) GCTACCCTGACCCTTCATC AAGCTTTCTGGGATGTCCAC TGACGCCATCTGCTACACAGGTGA
COMP (X74326, 72 bp) TCAGAAGAGCAACGCAGAC TCTTGGTCGCTGTCACAA CAGAGGGATGTGGACCACGACTTC
GAPDH (U85042, 86 bp) ACCCTCAAGATTGTCAGCAA ACGATGCCAAAGTGGTCA CCTCCTGCACCACCAACTGCTT
  1. bp, base pairs; COMP, cartilage oligomeric matrix protein; GAPDH; glyceraldehyde-3-phosphate dehydrogenase. aCollagen II primers detect both A and B isoforms.