Skip to main content

Advertisement

Table 2 GenBank accession numbers and primer sequences

From: Microarray gene expression profiling of osteoarthritic bone suggests altered bone remodelling, WNT and transforming growth factor-β/bone morphogenic protein signalling

Gene/primer (GenBank accession number) Forward Reverse
GAPDH (NM_002046) ACCCAGAAGACTGTGGATGG CAGTGAGCTTCCCGTTCAG
ADAMTS4 (NM_005099) GGCTACTACTATGTGCTGGAGC TCCGCACACCATGCACTTGTCA
ADM (NM_001124) GGATGAAGCTGGTTTCCGTC GACTCAGAGCCCACTTATTC
ADFP (NM_001122) GTTGCCAATACCTATGCCTG CAGTAGTCGTCACAGCATCT
CD14 (NM_000591) GAGGTTCGGAAGACTTATCG ATCTTCATCGTCCAGCTCAC
COL4A1 (NM_001845) TAGAGAGGAGCGAGATGTTC GTGACATTAGCTGAGTCAGG
CTNNB1 (NM_001904) GGTGCTATCTGTCTGCTCTAGT GACGTTGACTTGGATCTGTCAGG
FST (NM_006350) GGCAAGATGTAAAGAGCAGC CATTATTGGTCTGGTCCACC
GADD45B (NM_015675) TTGCAACATGACGCTGGAAG CATTCATCAACTTGGCCGAC
IBSP (NM_004967) CAATCCAGCTTCCCAAGAAG CTTCTGCTTCGCTTTCTTCG
INHBA (NM_002192) GAACTTATGGAGCAGACCTC TGCCTTCCTTGGAAATCTCG
INSIG1 (NM_005542) TGTATCGACAGTCACCTCGGA GGACAGCTGGACATTATTGGC
ITGB2 (NM_000211)) AAGTGACGCTTTACCTGCGA CCTGAGGTCATCAAGCATGG
KLF6 (NM_001300) TGTGCAGCATCTTCCAGGAG AACGTTCCAGCTCTAGGCAG
MEPE (NM_020203) GCAAAGCTGTGTGGAAGAGCAGA CCCTTATTCTCACTGGCTTCAG
MMP25 (NM_004142) ATGTCACCGTCAGCAACGCA CGGTCTTGATGCTGTTCTTG
MT2A (NM_005953) GCAAATGCACCTCCTGCAAG GTGGAAGTCGCGTTCTTTAC
NHERF1 (NM_004252) TCACCAATGGGGAGATACAG GTCTTGGGAATTCAGCTCCT
PTEN (NM_000314) AAGACAAAGCCAACCGATAC GAAGTTGAACTGCTAGCCTC
RUNX2 (NM_004348) TGATGACACTGCCACCTCTG GGGATGAAATGCTTGGGAAC
S100A4 (NM_002961) GTCAGAACTAAAGGAGCTGC TGTTGCTGTCCAAGTTGCTC
SMAD3 (NM_005902) TTCAACAACCAGGAGTTCGC TACTGGTCACAGTA
STC1 (NM_003155) CCTGTGACACAGATGGGATG GAATGGCGAGGAAGACCTTG
TIMP4 (NM_003256) TTGACTGGTCAGGTCCTCAGT GGTACTGTGTAGCAGGTGGT
TWIST1 (NM_000474) TCAGCAGGGCCGGAGACCTAGAT GTCTGGGAATCACTGTCCAC
WNT5B (AY009399) ACCCTACTCTGGAAACTGTC TAAACATCTCGGGTCTCTGC
  1. 'Slide' indicates the microarray slide comparison. Slides 1 to 10 are control (CTL)-osteoarthritis (OA) female sample pairs, slides 11 to 20 are CTL-OA male sample pairs, slides 21 to 30 are OA-osteoporosis (OP) female sample pairs and slides 32 to 40 are CTL-OP female sample pairs. GEO, Gene Expression Omnibus; ID, individual/sample.