Skip to main content

Table 1 Primers used in the study

From: Association of reduced heme oxygenase-1 with excessive Toll-like receptor 4 expression in peripheral blood mononuclear cells in Behçet's disease

Primer Sense/antisense Sequence
HO-1 Sense CAGGCAGAGAATGCTGAG
  Antisense GCTTCACATAGCGCTGCA
TLR2 Sense TGACTGCTCGGAGTTCTCCC
  Antisense GTCAGCACCAGAGCCTGGAG
TLR4 Sense GCGGCTCGAGGAAGAGAAGA
  Antisense AGGCTCTGATATGCCCCATC
GAPDH Sense ACAGTCAGCCGCATC
  Antisense AGGTGCGGCTCCCTA
TNF-α Sense ATGAGCACTGAAAGCATGATC
  Antisense GGCGATGCGGCTGATGGT
CD14 Sense CGGCCGAAGAGTTCACAAGT
  Antisense AGTGCAGTCCTGTGGCTTC
MD-2 Sense TAAATCTTTTCTGCTTACTGA
  Antisense TACTCAATTTATTCTAATTTGAAT
  1. HO, heme oxygenase; MD, Myeloid differentiation factor-2 ; TLR, Toll-like receptor; TNF, tumor necrosis factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.