Skip to main content

Table 1 Sequences of oligonucleotides used in polymerase chain reaction (PCR) and real-time PCR as well as for the generation of small interfering RNAs

From: DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management?

Primers for conventional DREAM PCR
  Forward Reverse
DREAM 5'-CCGGCTAAGGAAGTGACAAA-3' 5'-CAAAGGCGTTGAAGAGGAAG-3'
nDREAM 5'-GAAGGAGGGTATCAAGTG-3' 5'-TAAATGAGTTTGAAGGTGTC-3'
Primers for SYBR green assay real-time PCR
  Forward Reverse
c-fos 5'-TAAATGAGTTTGAAGGTGTC-3' 5'-ACAGGAACCCTCTAGGGAAGA-3'
Oligonucleotides for the synthesis of siRNAs
  Sense Antisense
siRNA1 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3'
siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'
siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'
siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3'
siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3'
siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3'
T7 5'-TAATACGACTCACTATAG-3'  
  1. siRNA3 (binding in the coding region of exon 6) and siRNA4 (spanning the non-coding exons 8 and 9) were used to interfere with endogenous DREAM mRNA and to analyze downstream target genes of DREAM gene regulation like pdyn and c-fos. Two different primers for DREAM are given. DREAM, downstream regulatory element antagonist modulator; GFP, green fluorescence protein; siRNA, small interfering RNA.