Skip to main content

Table 1 Reverse transcription-polymerase chain reaction primers for differentiation-specific gene expression analysis

From: Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells

Genes Primer sequences (5'-3') Position, base pairs Predicted size, base pairs
Housekeeping gene    
   GAPDH Sense: GGACTCATGACCACAGTCCATGCC 619–770 152
  Antisense: TCAGGGATGACCTTGCCCACA   
Bone-specific genes    
   ALP Sense: TGGAGCTTCAGAAGCTCAACACCA 379–832 454
  Antisense: ATCTCGTTGTCTGAGTACCAGTCC   
   OC Sense: ATGAGAGCCCTCACACTCCTC 19–312 294
  Antisense: GCCGTAGAAGCGCCGATAGGC   
Adipose-specific genes    
   LPL Sense: GAGATTTCTCTGTATGGCACC 1,457–1,732 276
  Antisense: CTGCAAATGAGACACTTTCTC   
   PPARγ Sense: TGAATGTGAAGCCCATTGAA 1,476–1,636 161
  Antisense: CTGCAGTAGCTGCACGTGTT   
Cartilage-specific genes    
   AGN Sense: TGCGGGTCAACAGTGCCTATC 655–836 182
  Antisense: CACGATGCCTTTCACCACGAC   
   COL2A1 Sense: GGAAACTTTGCTGCCCAGATG 710–876 167
  Antisense: TCACCAGGTTCACCAGGATTGC   
  1. AGN, aggrecan; ALP, alkaline phosphatase; COL2A1, collagen type II α1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LPL, lipoprotein lipase; OC, osteocalcin; PPARγ, peroxisome proliferator-activated receptor-gamma.