Skip to main content

Table 1 Primers for real-time PCR

From: Therapeutic efficacy of intra-articular adrenomedullin injection in antigen-induced arthritis in rabbits

Gene GenBank accession number Product (base pairs) Oligonucleotide sequences (forward and reverse primers)
TNFαa [GenBank:M12845] 252 AGCCCACGTAGTAGCAAACCC
    TTGATGGCAGAGAGGAGGTTGA
IL-6 [GenBank:AF169176] 93 CCGGCGGTGAATAATGAGAC
    CCTGAACTTGGCCTGAAGGTG
Vascular endothelial growth factor [GenBank:AY196796] 91 AATGATGAAAGCCTGGAGTGTGTG
    CTATGTGCTGGCCCTGGTGA
Transforming growth factor beta [GenBank:AB020217] 136 AAGGACCTGGGCTGGAAGTG
    CCGGGTTGTGCTGGTTGTA
β-Actin [GenBank:AF309819] 183 CCATGTACGTGGCCATCCAG
    TCTTCATGAGGTAGTCGGTCAGGTC
  1. aPrimer source was Reno and colleagues [15].
\