Skip to main content

Table 1 Exon-spanning PCR primers

From: Hypoxia upregulates angiogenesis and synovial cell migration in rheumatoid arthritis

  Forward (5' to 3') Reverse (5' to 3') Product size (base pairs)
ARP CTCTGGAGAAACTGCTGCC TGTAGATGCTGCCATTGTCG 378
VEGF GTCTTCAAGGAGCGCTGGTTCTG TAGCCCGGTTCTACCTTCAG 354
PlGF GAAGCCGGAAGGAGGAGAC GTCTGTGGCCTTCTCTC 321
MMP-1 GGAGATCATCGGGACAACTC ACCGGACTTCATATGTCG 529
MMP-2 CAAGTGGTCCGTGTGAAGTATG CGTCATCGTAGTTGGCTGTG 496
MMP-3 GACAAAGGATACAACAGGGACC TATCAGAAATGGCTGCATCG 575
MMP-8 GAAGCCGGAAGGAGGAGAC GTCTGTGGCCTTCTCTC 321
MMP-9 CAAGGATGGGAAGTACTGGCG TCAACTCACTCCGGGAACTC 464
MMP-13 GATACGTTCTTACAGAAG GACAAATCATCTTCATCACC 496
MT1-MMP GTCTTCAAGGAGCGCTGGTTCTG TAGCCCGGTTCTACCTTCAG 488
TIMP-1 CTTGCTGCTCTACCTCCACC CTGCATTCACATTTGTTGTGC 548
TIMP-2 GAGTGCAAGATCACGCGCGCTGCC TGGGAGATCCCTAAGTGCTG 469
  1. ARP, acidic ribosomal protein; MMP, matrix metalloproteinase; PlGF, placental growth factor; TIMP, tissue inhibitor of matrix metalloproteinase; VEGF, vascular endothelial growth factor.