Skip to main content

Table 1 Oligonucleotide primer pairs used for quantitative real-time RT-PCR

From: Impaired glucose transporter-1 degradation and increased glucose transport and oxidative stress in response to high glucose in chondrocytes from osteoarthritic versus normal human cartilage

Gene Primer sequence (5'-3') Product length (base pairs) GenBank accession number
Glucose transporter-1 Forward: CGTCTTCATCATCTTCACTG 148 [Genbank:NM_006516]
  Reverse: CTCCTCGGGTGTCTTATC   
β-Actin Forward: AACTACCTTCAACTCCAT 161 [Genbank:NM_001101]
  Reverse: TGATCTTGATCTTCATTGTG   
Cyclophilin A Forward: CAGTCCCAGGAAGTGTCAATG 155 [Genbank:NM_021130]
  Reverse: CAGCGTCTCACTATGTTGCC