Skip to main content

Table 2 Human oligonucleotide primers

From: Transcriptional profiling of bovine intervertebral disc cells: implications for identification of normal and degenerate human intervertebral disc cell phenotypes

Gene name Gene symbol NCBI ref. seq. Forward primer Reverse primer
Synaptosomal associated protein 25 SNAP25 NM_003081.2 CAATGAGCTGGAGGAGATGCA TGCTTTCCAGCGACTCATCA
Integrin-binding sialoprotein IBSP NM_004967.3 CCAGAGGAAGCAATCAC GCACAGGCCATTCCCAA
Brain attached signalling protein 1 BASP1 NM_006317.3 GCGGAGCCCGAGAAGAC GGCCTCAGCAGCTTTGG
  1. Human oligonucleotide primers used for quantitative real-time polymerase chain reaction (qRT-PCR).