Skip to main content

Advertisement

Table 2 Human oligonucleotide primers

From: Transcriptional profiling of bovine intervertebral disc cells: implications for identification of normal and degenerate human intervertebral disc cell phenotypes

Gene name Gene symbol NCBI ref. seq. Forward primer Reverse primer
Actin, beta ACTB NM_001101.3 CGAGAAGATGACCCAGATCATG ACAGCCTGGATAGCAACGTACA
Aggrecan ACAN NM_001135.2 TCTACCGCTGCGAGGTGAT TGTAATGGAACACGATGCCTTT
Versican VCAN NM_004385.4 GCCTTTCCTATCACCTCGAGAA CACGGCAACCCAAAATGACT
Collagen, type II, alpha 1 COL2A1 NM_001844.4 GGAAGAGTGGAGACTACTGGATTGAC TCCATGTTGCAGAAAACCTTCA
Synaptosomal associated protein 25 SNAP25 NM_003081.2 CAATGAGCTGGAGGAGATGCA TGCTTTCCAGCGACTCATCA
Keratin 8 KRT8 NM_002273.3 CACATCTGTGGTGCTGTCCAT GCCTTGACCTCAGCAATGATG
Keratin 18 KRT18 NM_000224.2 GCCTACAAGCCCAGATTGC GGCGAGGTCCTGAGATTTGG
Keratin 19 KRT19 NM_002276.4 CGCAGGGTGCTGGATGAG AGGTAGGCCAGCTCTTCCTT
N-Cadherin CDH2 NM_001792.3 AGCCTGGAACGCAGTGTAC GCGAACCGTCCAGTAGGAT
Integrin-binding sialoprotein IBSP NM_004967.3 CCAGAGGAAGCAATCAC GCACAGGCCATTCCCAA
Tenomodulin TNMD NM_022144.2 CAGTGGGTGGTCCCTCAAG GTCATTTATTGGAAGTTCTTCCTCACTTG
Brain attached signalling protein 1 BASP1 NM_006317.3 GCGGAGCCCGAGAAGAC GGCCTCAGCAGCTTTGG
Forkhead box F1 FOXF1 NM_001451.2 AAGCCGCCCTATTCCTACATC GCGCTTGGTGGGTGAACT
Fibulin 1 FBLN1 NM_006487.2 CCTTCGAGTGCCCTGAGAACTA ACCGATGGCCTCATGCA
T, brachyury homolog (mouse) T NM_003181.2 CAATGAGATGATCGTGACCAAGA GCCAGACACGTTCACCTTCA
  1. Human oligonucleotide primers used for quantitative real-time polymerase chain reaction (qRT-PCR).