Skip to main content

Table 1 Oligonucleotide sequences

From: Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts

Name Sequence
Electrophoretic mobility shift assay  
   MMP-1 AP-1 S CTAGTGATGAGTCAGCCGGATC
   MMP-1 AP-1 AS GATCCGGCTGACTCATCACTAG
Chromatin immunoprecipitation  
   MMP-1 AP-1 fw CCTCTTGCTGCTCCAATATC
   MMP-1 AP-1 rv TCTGCTAGGAGTCACCATTTC
   MMP-2 AP2 fw GTGGAGGAGGGCGAGTAGGG
   MMP-2 AP2 rv CTGGGAGGGAGCTGGCAGAG
   MMP-9 AP-1 fw GAGAGGAGGAGGTGGTGTAAG
   MMP-9 AP-1 rv TTAAGGAGGCGCTCCTGTG
   COL1A1 -200/+100 fw CAGAGCTGCGAAGAGGGGA
   COL1A1 -200/+100 rv AGACTCTTTGTGGCTGGGGAG
   COL1A2 fw2 GCGGAGGTATGCAGACAACG
   COL1A2 rv1 GGGCTGGCTTCTTAAATTG
   MMP-1 ORF fw TAAGTACTGGGCTGTTCAGG
   MMP-1 ORF rv GAGCAGCATCGATATGCTTC
   COL1A2 ORF fw GCCCTCAAGGTTTCCAAG
   COL1A2 ORF rv GGGAGACCCATCATTTCAC
Reverse transcription-polymerase chain reaction  
   COL1A1 Hs00164004_m1
   COL1A2 Hs00164099_m1
   TIMP-1 Hs00171558_m1
   MMP-1 Hs00233958_m1
   MMP-2 Hs00234422_m1
   HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT
DNA pull-down assay  
   Biotin-MMP-1-S GATCGAGAGGATGTTATAAAGCATGAGTCAG
   Biotin-MMP-1-AS CTGACTCATGCTTTATAACATCCTCTCGATC
   Biotin-COL1A2-S GAAAGGGCGGGGGAGGGCGGGAGGATGCGGAGGGCGGAG
   Biotin-COL1A2-AS CTCCGCCCTCCGCATCCTCCCGCCCTCCCCCGCCCTTTC
  1. Bold case indicates proximal activation protein-1 (AP-1) site. Underlining indicates transcription binding sites (Ets and AP-1 for matrix metalloproteinase-1 [MMP-1] and SP1 for collagen 1A2 [COL1A2]).