Skip to main content

Table 1 Information of primers for conventional PCR and Real-time PCR

From: Toll-like receptor 3 upregulation in macrophages participates in the initiation and maintenance of pristane-induced arthritis in rats

Gene name NCBI Accession No. Sequence(5'-3') Size (bp) annealing temperature (°C)
TLR1 NM_001172120 forward CAGCAGCCTCAAGCATGTCTA   
   reverse CAGCCCTAAGACAACAATACAATAGAAGA 82 60
TLR2 NM_198769 forward CTCCTGTGAACTCCTGTCCTT   
   reverse AGCTGTCTGGCCAGTCAAC 74 60
TLR3 NM_198791 forward GATTGGCAAGTTATTCGTC   
   reverse GCGGAGGCTGTTGTAGG 205 54
TLR4 NM_019178 forward GATTGCTCAGACATGGCAGTTTC   
   reverse CACTCGAGGTAGGTGTTTCTGCTAA 135 54
TLR5 XM_001063885 forward GGGCAGCAGAAAGACGGTAT   
   reverse CAGGCACCAGCCATCCTTAA 61 60
TLR6 NM_207604 forward AGAACCTTACTCATGTCCCAAAAGAC   
   reverse AGATCAGATATGGAGTTTTGAGACAGACT 79 60
TLR7 NM_001097582 forward GTTTTACGTCTACACAGTAACTCTCTTCA   
   reverse TTCCTGGAGGTTGCTCATGTTTT 75 60
TLR8 NM_001101009 forward GGGGTAACACACCGTCTA   
   reverse GTCAAGGCGATTTCCACT 150 60
TLR9 NM_198131 forward CCGAAGACCTAGCCAACCT   
   reverse TGATCACAGCGACGGCAATT 70 60
TNF-α NM_012675 forward TCAGCCTCTTCTCATTCCTGC   
   reverse TTGGTGGTTTGCTACGACGTG 203 60
IL-6 NM_012589 forward AAGAAAGACAAAGCCAGAGTC   
   reverse CACAAACTGATATGCTTAGGC 263 60
IFN-γ NM_138880 forward CCCTCTCTGGCTGTTACTGC   
   reverse TTTCGTGTTACCGTCCTTTTG 149 54
IFN-β NM_019127 forward CTTGGGTGACATCCACGACTAC   
   reverse GGCATAGCTGTTGTACTTCTTGTCTT 92 54
β-actin NM_031144 forward GAGGGAAATCGTGCGTGAC   
   reverse GCATCGGAACCGCTCATT 157 60
gfp - forward GGCACCGATTTCAAGGAG   
   reverse CGCCGATGGGGGTATTCT 190 54