Skip to main content

Advertisement

Table 2 Primer pairs for PCR detection

From: Increased activity and expression of histone deacetylase 1 in relation to tumor necrosis factor-alpha in synovial tissue of rheumatoid arthritis

HDAC1 F AGACAGCTGTGGCCCTGGATAC
  R CGGCAGCATTCTAAGGTTCTCAA
HDAC2 F TGCAGTTGCCCTTGATTGTGA
  R ATCTGGACACCAGGTGCATGAG
HDAC3 F AGAGTGGCCGCTACTACTGTCTGAA
  R TGGGTTGGTAGAAGTCCACTACCTG
HDAC4 F GAGCAGGAGCTGGAGAAG
  R AATGCAGTGGTTCAGATTCC
HDAC5 F GTGTCTCGGCTCTGCTCAGTGTAG
  R TTTGCTGCAAGACTGCCTCATC
HDAC6 F GTCTACTGTGGTCGTTACATC
  R GGCCTGACAGTAGTAACAC
HDAC7 F CGGGTGCACAGTAAATAC
  R CCAGAGCCTTAGAGATTCATA
HDAC8 F TGACGGAATGTGCAAAGTAGCAA
  R TCAAATTTCCGTCGCAATCGTA
β-actin F TTCCTGGGCATGGAGTCCT
  R AGGAGGAGCAATGATCTTGATC