Skip to main content

Table 1 Primer sequences for the present study

From: Modulation of transforming growth factor beta signalling pathway genes by transforming growth factor beta in human osteoarthritic chondrocytes: involvement of Sp1 in both early and late response cells to transforming growth factor beta

Primer Sequence (5' to 3')
  Sense Antisense
TβRI TTAAAAGGCGCAACCAAGAAC GTGGTGATGAGCCCTTCGAT
TβRII GACATCAATCTGAAGCATGAGAACA GGCGGTGATCAGCCAGTATT
Smad2 GCTGTTTTCCTAGCGTGGCTT TCCAGACCCACCAGCTGACT
Smad3 GCATCAGCCGCTTCTCAAGT ATCTCCCCACCATCACCTCC
Smad4 CCTTCTGGAGGAGATCGCT TCAATGGCTTCTGTCCTGTGG
Smad7 AATGTGTTTTCTAGATTCCCAACTTCTT CACTCTCGTCTTCTCCTCCCAGTA
Sp1 AGAATTGAGTCACCCAATGAGAACA GTTGTGTGGCTGTGAGGTCAAG
COL2A1 GGCAATAGCAGGTTCACGTACA CGATAACAGTCTTGCCCCACTT
COL1A1 CACCAATCACCTGCGGTACAGAA CAGATCACGTCATCGCACAAC
COL10A1 CCTGGTATGAATGGACAGAAAGG CCCTGAGGGCCTGGAAGA
Aggrecan TCGAGGACAGCGAGGCC TCGAGGGTGTAGCGTGTAGAGA
Sox9 CCC ATG TGG AAG GCA GAT G TTC TGA GAG GCA CAG GTG ACA