Skip to main content

Advertisement

Table 1 Summary of primers used for quantitative real-time PCR

From: Modulation of interleukin-1β-induced inflammatory responses by a synthetic cationic innate defence regulator peptide, IDR-1002, in synovial fibroblasts

Gene Forward primer Reverse Primer
IL-1RA ttggaaggctctgaacctca ctgaaggcttgcatcttgct
SIGIRR ctcagagccatgccaggt cctcagcacctggtcttca
18sRNA gtaacccgttgaaccccatt ccatccaatcggtagtagcg