Skip to main content

Advertisement

Table 1 Real-time PCR primer sequences

From: Fibroblast growth factor receptor 1 is principally responsible for fibroblast growth factor 2-induced catabolic activities in human articular chondrocytes

Gene Primer Sequence (5'→3') NCBI Gene Number Anneal Tm
MMP13 F: ACCCTGGAGCACTCATGTTTCCTA R: TGGCATCAAGGGATAAGGAAGGGT NM_002427.3 60°C
ADAMTS5 F: CTGTGACGGCATCATTGGCTCAAA R: TTCAGGAATCCTCACCACGTCAGT NM_007038.3 60°C
ACAN F: TCTTGGAGAAGGGAGTCCAACTCT R: ACAGCTGCAGTGATGACCCTCAGA NM_001135.3 60°C
FGFR1 F: AACCTGACCACAGAATTGGAGGCT R: ATGCTGCCGTACTCATTCTCCACA NM_023110.2 60°C
FGFR2 F: TGATGGACTTCCTTATGTCCGCGT R: AGCGTCCTCTTCTGTGACATTGGT NM_000141.4 60°C
FGFR3 F: ACCAATGTGTCTTTCGAGGATGCG R: AGAGCACGCAGCTTGTCACATAGA NM_000142.4 60°C
FGFR4 F: ATGGAACTGGTGTGCTCAAGAAGC R: TTCACATGTCCTCCGACCAACACA NM_002011.3 60°C
18S rRNA F: CGGCTACCACATCCAAGGAA R: GCTGGAATTACCGCGGCT NR_003286.2 60°C
GAPDH F: TCGACAGTCAGCCGCATCTTCTTT R: GCCCAATACGACCAAATCCGTTGA NM_002046.3 60°C
  1. ACAN, aggrecan core protein; ADAMTS5, a disintegrin and metalloproteinase with a thrombospondin type 1 motif 5; FGFR, fibroblast growth factor receptor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; MMP13, matrix metalloproteinase-13.