Skip to main content

Table 1 Primers used for real-time reverse transcription-polymerase chain reaction

From: An organ culture system to model early degenerative changes of the intervertebral disc

Target genes Sequence (5' to 3') Size, base pairs
  F: TGGCCAAGAAGACATCCCTGAAGT  
Collagen type 1 R: ACATCAGGTTTCCACGTCTCACCA 81
  F: GAGTGGAAGAGCGGAGACTACTG  
Collagen type 2 R: CTCCATGTTGCAGAAGACTTTCA 81
  F: TTCATGCATCCGCTAGTCCCTTCT  
Collagen type 6 R: CCTTTATTGGGCCATTGGGCATGT 136
  F: TCGTGGATGTGGTGCTGAAGATGA  
Collagen type 9 R: ATTGGGTCCCTGTTTGCCTGGATA 146
  F: TGTCCAACAACCTGTGGAGGAAGA  
Fibromodulin R: CGTTGTGTGTGTGTGTGTGTGTGT 113
  F: AAGGACTGTCTATCTGCACGCCAA  
Aggrecan R: TCACCACCCACTCCGAAGAAGTTT 126
  F: ATTGGCACAAAGGTGGATGCTGTC  
MMP-3 R: ACGACGCCTTCCATGGATCTTCTT 160
  F: TTCTCGAATCACGGAGGAAGCCAA  
MMP-9 R: AAGGCTGAGTTCAACTTTGCAGGC 89
  F: ACTTGTGTGACAGGAGCTAAGGCA  
MMP-13 R: AGGAGCATGAAAGGGTGGTCTCAA 119
  F: CTGGCCAATGGCATGGATCTCAAA  
TNF-α R: ATGAAATGGCAAATCGGCTGACGG 148
  F: ACCTGCTAGTGTGTGATGTTCCCA  
IL-1β R: AGGTGGAGAGCTTTCAGCTCACAT 109
  F: ACTTCCAGGCCCATGGTACAATCT  
NGF R: TTGATGTCCGTGGCTGTGGTCTTA 148
  F: AGTCCCTGCCCTTTGTACACA  
18S R: GATCCGAGGGCCTCACTAAAC 68
  1. F, forward primer; R, reverse primer; IL-1β, interleukin-1beta; MMP, matrix metalloproteinase; NGF, nerve growth factor; TNF-α, tumor necrosis factor-alpha.