Skip to main content

Table 1 Real-time RT-PCR Primers, annealing temperatures and Accession Numbers of genes evaluated

From: Notochordal cells protect nucleus pulposus cells from degradation and apoptosis: implications for the mechanisms of intervertebral disc degeneration

Gene Primer Sequence Annealing Temp °C Accession Number
Aggrecan F CCTGAACGACAAGACCATCGA 58 U76615
Aggrecan R TGGCAAAGAAGTTGTCAGGCT 58  
Collagen 2 F AAGAAGGCTCTGCTCATCCAGG 58 X02420
Collagen 2 R TAGTCTTGCCCCACTTACCGGT 58  
MMP3 F CACTCAACCGAACGTGAAGCT 58 AF135232
MMP3 R CGTACAGGAACTGAATGCCGT 58  
TIMP1 F TCCCTGGAACAGCATGAGTTC 58 AF144763
TIMP1 R TGTCGCTCTGCAGTTTGCA 58  
ADAMTS4 F CCTGGCAACGAGGACTCAAC 58 NM_181667.1
ADAMTS4 R GGGTAAACAGAATGGCTGTGTCA 58  
CD44 F CGGGTTCATAGAAGGGCATGT 58 X62881.1
CD44 R TTGTTCGCAGCACAGATGGA 58  
Link protein F AAGCTGACCTACGACGAAGCG 58 NM_174288.1
Link protein R CGCAACGGTCATATCCCAGA 58  
IL-6 F CTGGGTTCAATCAGGCGAT 58 NM_173923.2
IL-6 R CAGCAGGTCAGTGTTTGTGG   
ANKH F
ANKH R
TCGGTGTGGACTTTGCCTTT
ACTGGAACCGGGAAGAAGGA
58 NP_001103263