Skip to main content

Table 1 Oligonucleotide primers used in real-time PCR assay

From: Bone morphogenetic protein-2-induced Wnt/β-catenin signaling pathway activation through enhanced low-density-lipoprotein receptor-related protein 5 catabolic activity contributes to hypertrophy in osteoarthritic chondrocytes

Gene Forward primer sequence Reverse primer sequence
BMP-2 CCCAGCGTGAAAAGAGAGAC GGAAGCAGCAACGCTAGAAG
BMPR-IA TTTATGGCACCCAAGGAAAG TGGTATTCAAGGGCACATCA
LEF-1 CCCTTCCAACTCTCCTTTCC TTGAAGGGGATCATCTCGTC
Osteocalcin AGAGTCCAGCAAAGGTGCAG TCAGCCAACTCGTCACAGTC
LRP-5 GTGCCTGGGTGAGATTCTTC CACGAAGACTGCGAAACAGA
MMP-7 TGCTCACTTCGATGAGGATG TGGGGATCTCCATTTCCATA
MMP-13 TGGCATTGCTGACATCATGA GCCAGAGGGCCCATCAA
MMP-14 GAGCTCAGGGCAGTGGATAG GGTAGCCCGGTTCTACCTTC
MMP-9 TTGACAGCGACAAGAAGTGG GCCATTCACGTCGTCCTTAT
BMP-4 ATGAAGCCCCCAGCAGAAGT TCACATTGTGGTGGACCAGTC
ADAMTS-4 TCCTGCAACACTGAGGACTG GGTGAGTTTGCACTGGTCCT
ADAMTS-5 CAGCAGTGCAACCTGACATT CAGATTCTCCCCTTTCCACA
COL10A1 CAGGCATAAAAGGCCCAC GTGGACCAGGAGTACCTTGC
COL2A1 ATGACAATCTGGCTCCCAACACTGC GACCGGCCCTATGTCCACACCGAAT
Aggrecan TGAGGAGGGCTGGAACAAGTACC GGAGGTGGTAATTGCAGGGAACA
GAPDH GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG