Skip to main content

Table 2 Oligonucleotide primers used for ChIP assay

From: Bone morphogenetic protein-2-induced Wnt/β-catenin signaling pathway activation through enhanced low-density-lipoprotein receptor-related protein 5 catabolic activity contributes to hypertrophy in osteoarthritic chondrocytes

Gene Forward primer Reverse primer
MMP-13 GGACGGTGGTCAAGAACATT GGCTAGCACAAACAGGGATT
MMP-9 TAAGACATTTGCCCGAGGTC CTCCCTGACAGCCTTCTTTG
MMP-14 TCTCCCACACTTTTCCTGCT AAGAAGGGATTGGGAGTTGG
ADAMTS-5 TTTCTTCCCTTCCTCCTGGT TCAGCAAATACGGGAAAAGG
COL10A1 GGAATTGTCCTCCTCAACCA CACTTTCCCTCAAAGGTGGA
LRP-5 GTTCCAGAGCCCCTTCTGT CCGGACACTTGTTCTCACCT