Skip to main content

Table 2 List of the sequence of gene primers.

From: Interleukin-29 modulates proinflammatory cytokine production in synovial inflammation of rheumatoid arthritis

Gene name Forward (5' to 3') Reverse (5' to 3')
Human IL-29 GAAGCAGTTGCGATTTAGCC GAAGCTCGCTAGCTCCTGTG
Human IL-28Rα CCTCCCCAGAATGTGACGC GGAGCCATGTCAGGTACACG
Human IL-6 AACCTGAACCTTCCAAAGATGG TCTGGCTTGTTCCTCACTACT
Human IL-8 CATACTCCAAACCTTTCCACCCC TCAGCCCTCTTCAAAAACTTCTCCA
Human IL-10 CAAATGAAGGATCAGCTGGACAA GCATCACCTCCTCCAGGTAAAAC
Human IL-17 CCCGGACTGTGATGGTCAAC GCACTTTGCCTCCCAGATCA
Human MMP-3 CAGGCTTTCCCAAGCAAATA TTGCATTTGGGTCAAACTCC
Human GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC