Skip to main content

Supplementary Table 1 PCR primer location and sequence

From: Production of interleukin-1 receptor antagonist by human articular chondrocytes

Primer Gene GenBank Location (bp)* Sequence 5'-3'
A IL-1RN U65590 16,106–16,131 (s) CAGGTACTGCCCGGGTGCTACTTTAT
B IL-1RN U65590 25,827–25,852 (s) GGCCTCCGCAGTCACCTAATCACTCT
C IL-1RN U65590 30,881–30,856 (as) TACTACTCGTCCTCCTGGAAGTAGAA
D IL-1RN U65590 26,130–26,109 (as) GGTCGCACTATCCACATCTGGG
E β-Actin M10277 1559–1583 (s) CCAAGGCCAACCGCGAGAAGATGAC
F β-Actin M10277 2681–2658 (as) AGGGTACATGGTGGTGCCGCCAGAC
G IL-1RN U65590 29134–29115 (as) TTGACACAGGACAGGCACAT
H GAPDH M32599 140–157 (s) AACGACCCCTTCATTGAC
I GAPDH M32599 330–312 (as) TCCACGACATACTCAGCAC
  1. *Sense (s) or antisense (as) orientation with respect to the corresponding gene is indicated. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.