Skip to main content

Table 2 Primer sequences.

From: Characterisation of fibroblast-like synoviocytes from a murine model of joint inflammation

Gene Fwd Rvs
18S CATGATTAAGAGGGACGGC TTCAGCTTTGCAACCATACTC
IL-6 AGTTGCCTTCTTGGGACTGA GGTAGCATCCATCATTTCTTTGTA
CCL-2 AGAAGTCATAGCCACTCTCAAGG TGAACTCTCAGACAGCGAGG
VCAM-1 GGAGACCTGTCACTGTCAACTG TCCATTTCACCACTGTGTAACC
ICAM-1 AGACACAAGCAAGAAGACCACA TGACCAGTAGAGAAACCCTCG
BGLAP GCTCTGTCTCTCTGACCTCACA TAGATGCGTTTGTAGGCGG
CD68 GCTTCTGCTGTGGAAATGC GGTAGGTTGATTGTCGTCTGC
P4htm GATTGTGGAGTTCAGTGAGCC TTCATCATAGGTCCTGTTGTCTG
CD248 GCCAGCAGATGTGTGTCAA GTAGGTGCCAGCCATAGGAT