Skip to main content

Table 1 Primer and probe sequences.

From: Anti-inflammatory properties of a dual PPARgamma/alpha agonist muraglitazar in in vitro and in vivomodels

Gene Oligonucleotide Sequence 5' → 3'
Human GAPDH Forward primer TCCTACCACCAGCAACCCTGCCA
  Reverse primer GCAACAATATCCACTTTACCAGAGTTAA
  Probe CGCCTGGTCACCAGGGCTGC
Luciferase Forward primer ACGGCTTCGGCATGTTCA
  Reverse primer CTCCTCCTCGAAGCGGTACA
  Probe TTGATCTGCGGCTTTCGGGTCGT
Mouse GAPDH Forward primer GCATGGCCTTCCGTGTTC
  Reverse primer GATGTCATCATACTTGGCAGGTTT
Mouse IL-6 Probe TCGTGGATCTGACGTGCCGCC
  Forward primer TCGGAGGCTTAATTACACATGTTC
  Reverse primer CAAGTGCATCATCGTTGTTCATAC
  Probe CAGAATTGCCATTGCACAACTCTTTTCTCA
Mouse iNOS Forward primer CCTGGTACGGGCATTGCT
  Reverse primer GCTCATGCGGCCTCCTT
  Probe CAGCAGCGGCTCCATGACTCCC