Skip to main content

Table 1 Matrix metalloproteinase 2 (MMP-2) shRNA sequences

From: MMP-2 mediates local degradation and remodeling of collagen by annulus fibrosus cells of the intervertebral disc

Sequence name Top and bottom "stem-loop-stem" sequences, 5 to 3
shMMP2a CACCGCTGAAGGACACCCTCAAGAACGAATTCTTGAGGGTGTCCTTCAGC
  AAAAGCTGAAGGACACCCTCAAGAATTCGTTCTTGAGGGTGTCCTTCAGC
shMMP2b CACCGCCGGGATAAGAAGTATGGATTCTCGAAAGAATCCATACTTCTTATCCCGG
  AAAACCGGGATAAGAAGTATGGATTCTTTCGAGAATCCATACTTCTTATCCCGGC
shMMP2c CACCGCTGTGTTCTTCGCAGGGAATCGAAATTCCCTGCGAAGAACACAGC
  AAAAGCTGTGTTCTTCGCAGGGAATTTCGATTCCCTGCGAAGAACACAGC
shMMP2d CACCGCAATACCTGAACACTTTCTACGAATAGAAAGTGTTCAGGTATTGC
  AAAAGCAATACCTGAACACTTTCTATTCGTAGAAAGTGTTCAGGTATTGC
shMMP2e CACCGTGGTGGTCACAGCTATTTCTTCCGAAGAAGAAATAGCTGTGACCACCA
  AAAATGGTGGTCACAGCTATTTCTTCTTCGGAAGAAATAGCTGTGACCACCAC
shNon CACCGCCGATTAGCTGATCGTGCTTAGTCGAAACTAAGCACGATCAGCTAATCGG
  AAAACCGATTAGCTGATCGTGCTTAGTTTCGACTAAGCACGATCAGCTAATCGGC