Versican is upregulated in circulating monocytes in patients with systemic sclerosis and amplifies a CCL2-mediated pathogenic loop

Table 2 Primer sequences, annealing temperatures, and cycles used for semiquantitative PCR

Gene	Sense primer (5' → 3')	Antisense primer (5' → 3')	Annealing temperature (ºC)	Cycle
CCL2	agcaagtgtcccaaagaagc	gcaatttccccaagtcctg	66	32
Type I collagen α1	cctggatgccatcaaagtct	ccttcttgaggttgccagtc	66	33
Versican	tcattcaacgtcaccttcca	ggtccaaaaatccaaaccaa	66	34
L-selectin	tcagctgctctgaaggaaca	taaccatgactgccactgga	60	30
CCR1	tcctcacgaaagcctacgaggagagtccaagc	ccacggagaggagggagccatttaac	66	30
CXCL8	cagttttgccaaggagtgct	attgcatctggcaaccctac	63	27
MMP-2	ccaaggagagctgcaacct	ccaaggtccatagctcatcgtc	63	40
CCRL2	ctgggctcatgctggggg	tgcagcagtgggtggtgg	60	30
GAPDH	tgaacgggaagctcactgg	tccaccaccctgttgctgta	60	25
Versican variants
Versican V0	tcaacatctcatgttctccc	ttcttcactgtgggtataggtcta	57	34
Versican V1	ggctttgaccagtgcgattac	ttcttcactgtgggtataggtcta	57	28
Versican V2	tcaacatctcatgttctccc	ccagccatagtcacatgtctc	65	38
Versican V3	ggctttgaccagtgcgattac	ccagccatagtcacatgtctc	61	32