Skip to main content

Table 2 Primer sequences, annealing temperatures, and cycles used for semiquantitative PCR

From: Versican is upregulated in circulating monocytes in patients with systemic sclerosis and amplifies a CCL2-mediated pathogenic loop

Gene Sense primer (5' → 3') Antisense primer (5' → 3') Annealing temperature (ºC) Cycle
CCL2 agcaagtgtcccaaagaagc gcaatttccccaagtcctg 66 32
Type I collagen α1 cctggatgccatcaaagtct ccttcttgaggttgccagtc 66 33
Versican tcattcaacgtcaccttcca ggtccaaaaatccaaaccaa 66 34
L-selectin tcagctgctctgaaggaaca taaccatgactgccactgga 60 30
CCR1 tcctcacgaaagcctacgaggagagtccaagc ccacggagaggagggagccatttaac 66 30
CXCL8 cagttttgccaaggagtgct attgcatctggcaaccctac 63 27
MMP-2 ccaaggagagctgcaacct ccaaggtccatagctcatcgtc 63 40
CCRL2 ctgggctcatgctggggg tgcagcagtgggtggtgg 60 30
GAPDH tgaacgggaagctcactgg tccaccaccctgttgctgta 60 25
Versican variants     
   Versican V0 tcaacatctcatgttctccc ttcttcactgtgggtataggtcta 57 34
   Versican V1 ggctttgaccagtgcgattac ttcttcactgtgggtataggtcta 57 28
   Versican V2 tcaacatctcatgttctccc ccagccatagtcacatgtctc 65 38
   Versican V3 ggctttgaccagtgcgattac ccagccatagtcacatgtctc 61 32