Skip to main content

Table 2 Primers used for quantitative real-time PCR validation.

From: Genomic characterization of remission in juvenile idiopathic arthritis

Gene symbol Primer direction1 Primer sequence (5' ~ 3')
BIRC3 F CATGGGTTCAACATGCCAAGTGGT
BIRC3 R TTCATCTCCTGGGCTGTCTGATGT
C3 F GTGGAAATCCGAGCCGTTCTCT
C3 R GATGGTTACGGTCTGCTGGTGA
CCR2 F AGTTCAGAAGGTATCTCTCGGTG
CCR2 R GGCGTGTTTGTTGAAGTCACT
CCR6 F CTGAACCCTGTGCTCTACGCTT
CCR6 R CACAGGAGAAGCCTGAGGACTT
CD22 F GCGCAGCTTGTAATAGTTGGTGC
CD22 R CACATTGGAGGCTGACCGAGTT
CXCR6 F CAGTTCAGCAAGGTCTTTCTGCC
CXCR6 R AGGTTCACCAGGAACACATCCG
EFR3A F ATTCAGTGCCATGTGCCATTCCTG
EFR3A R GCCCGAAGTTCATCGTTGACTGTT
FOXO1 F CTACGAGTGGATGGTCAAGAGC
FOXO1 R CCAGTTCCTTCATTCTGCACACG
FUZ F AGCCAGTTGTATCCACAGCTTCTG
FUZ R CCGAGGATGTCTGTGTGAAGGG
GM2A F TCGTTCCTGGAAATGTGACCCTCA
GM2A R CAGCTGCCAATGTAGTCTGTGCAT
GZMA F CCACACGCGAAGGTGACCTTAA
GZMA R CCTGCAACTTGGCACATGGTTC
IER5 F ACCTCATCAGCATCTTCGGTTCCA
IER5 R TTCATGTCTCTCAGCACCGGCTTA
IL6ST F CACCCTGTATCACAGACTGGCA
IL6ST R TTCAGGGCTTCCTGGTCCATCA
KLRD1 F GAGCCAGCATTTACTCCAGGAC
KLRD1 R GCACAGAGATGCCGACTTTCGT
KMO F ATACTCGAGTGGCTACCTTCACAC
KMO R TCTGATCTTCCAGGCCAACAGCTT
NBN F TCTGTCAGGACGGCAGGAAAGA
NBN R CACCTCCAAAGACAACTGCGGA
NSMAF F GTCTGAACACCTTCACGAGTGG
NSMAF R CTGTTCAAGTCTACACCTCCTTC
RNF167 F ATGGGTCAGTCTTTATTGCGCTGC
RNF167 R ATCCAGCCTTCTGGGCATTTAGGA
STAT1 F ATGGCAGTCTGGCGGCTGAATT
STAT1 R CCAAACCAGGCTGGCACAATTG
TARP F CCCCAAGCCCACTATTTTTC
TARP R TGTTGCTCTTCTTTTCTTGCC
TNFAIP6 F TCACCTACGCAGAAGCTAAGGC
TNFAIP6 R TCCAACTCTGCCCTTAGCCATC
TRAF3 F AGCAGAGGTTGTGCAGAGCAGTTA
TRAF3 R TCATCGGAACCTGACTCTTGCAGT
TRGV5 F TGACTCAGGAAGACCAGCTC
TRGV5 R TCTTAAAACTCCGGCCCCAC
TRIM4 F ACGCCACACAGTGGAAGGATAAGA
TRIM4 R TCTTCAACCAGGAAGTTGTGCAGC
TST F TTCCAGCTGGTGGATTCAAGGTCT
TST R AGAGATCCACCTTCTTGGTCTGGA
UBTF F ATGGATTCATAAGGCCCTGGAGCA
UBTF R TTTGTCCGAGAGCTGAGACCACT
XIAP F TGGCAGATTATGAAGCACGGATC
XIAP R AGTTAGCCCTCCTCCACAGTGA
ZNF277 F AATGCAGGAAGACCGTGATGGGA
ZNF277 R AGCGGCTCCAGGATACAATCCTTA
  1. 1Forward primer direction (F), reverse primer direction (R).