Skip to main content

Table 1 Beacon designer sequences and real-time reaction efficiencies of qPCR assays

From: Low oxygen tension increased fibronectin fragment induced catabolic activities - response prevented with biomechanical signals

Gene Accession number Sequences nM Efficiency
iNOS U14640 Probe:5′-FAM- CGCGATC CCTGCTTGGTGGCGAAGATGAGC GATCGCG - 200  
   DABCYL-3′ 200 2.01
Forward: 5′-GTAACAAAGGAGATAGAAACAACAGG-3′ 200 (± 0.08)
Reverse: 5′-CAGCTCCGGGCGTCAAAG-3′   
   Probe: 5′-FAM-   
COX-2 AF031698 CGCGATC GTCAGAAATTCGGGTGTGGTACAGTT GATCGCG -DABCYL-3′ 200  
   Forward: 5′-CGAGGTGTATGTATGAGTGTAGG-3′ 300 1.99
Reverse: 5′-GTTGGGAGTGGGTTTCAGG-3′= 300 (± 0.04)
   Probe: 5′-FAM- 200  
Aggrecan U76615 CGCGATC CACTCAGCGAGTTGTCAGGTTCTGA GATCGCG -DABCYL-3′   2.05
   Forward: 5′-TGGTGTTTGTGACTCTGAGG-3′ 100 (± 0.07)
Reverse: 5′-GATGAAGTAGCAGGGGATGG-3′ 200  
Collagen type II X02420 Probe: 5′-FAM- CGCGAT GCGTCAGGTCAGGTCAGCCAT ATCGCG -   
DABCYL-3′ 200  
Forward: 5′-AAACCCGAACCCAGAACC-3′ 100 1.96
Reverse: 5′-AAGTCCGAACTGTGAGAGG-3′ 100 (± 0.08)
GAPDH U85042 Probe: 5′-HEX- CGCGATC CACCATCTTCCAGGAGCGAGATCC GATCGCG -   
DABCYL-3′ 200 1.96
Forward: 5′-TTCAACGGCACAGTCAAGG-3′ 200 (± 0.01)
Reverse: 5′-TTCAACGGCACAGTCAAGG-3′ 200  
  1. Note: Real-time reaction efficiencies of qPCR assays with optimal primer and probe concentrations are shown. Probes contain FAM or HEX as a 5′- reporter dye and DABCYL as 3′- quencher with the arm sequences underlined.