Skip to main content

Table 1 Genes and primers for RT-qPCR and 3UTR cloning

From: MicroRNA-26a negatively regulates toll-like receptor 3 expression of rat macrophages and ameliorates pristane induced arthritis in rats

Gene symbol (accession number) Primer name Annealing temperature (°C) Sequences (from 5′ to 3′)
TLR3 [GenBank:NM_198791] Sense 60 GATTGGCAAGTTATTCGTC
Antisense GCGGAGGCTGTTGTAGG
3′UTR sense 60 CGAGCTCTTTGGAGTCAGTGAAGGGAT
3′UTR antisense GAAGCTTCCCATGTATTTATTTGGAGCAA
3′UTR mutation sense 58 GTCTGAGTTTTTCATCAAAGTTTGTAT
3′UTR mutation Antisense ATACAAACTTTGATGAAAAACTCAGAC
GAPDH [GenBank:NM_017008] Sense 65 CGGCAAGTTCAACGGCACAG
Antisense GAAGACGCCAGTAGACTCCACGAC
IFNB [GenBank:NM_019127] Sense 54 CTTGGGTGACATCCACGACTAC
Antisense GGCATAGCTGTTGTACTTCTTGTCTT
TNFA [GenBank:NM_012675] Sense 60 TCAGCCTCTTCTCATTCCTGC
Antisense TTGGTGGTTTGCTACGACGTG
rno-miR-26a [miRBase: MIMA0000796] RT - GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCTA
Sense 60 CGCTTCAAGTAATCCAGGA
Antisense GTGCAGGGTCCGAGGT
U6 snRNA [GenBank:K00784] Sense 60 CTCGCTTCGGCAGCACA
Antisense AACGCTTCACGAATTTGCGT