Skip to main content

Table 1 Primers sequence used for genotyping analysis

From: Genetic, clinical and radiographic signs in knee osteoarthritis susceptibility

Target gene polymorphism Forward primer (5′ to 3′) Reverse primer (5′ to 3′) Template size (base pairs)
FRZB (rs288326; OS1A) cctcttggcagcaattggaac gcccctctcccaagaaaaatg 800
FRZB (rs7775; OS1B) agggcaggaccttgtctgtt taagagtctgcccccaaacc 884
MATN3 (rs77245812; OS2) tcacgtcacttcaggctgtg tggggtctcaccatgttctc 886
ASPN (D14; OS3) gcacattgctgaattgctttcca ctttggggtttgctgtactttc 615
PTH2R (rs144641723; OS4) tctcgaaccagtccctgct cccatgacagttgctgtgg 602
GDF5 (rs143383; OS5) gcagatgaattccaggtccag ccatgaggtggaggtgaaga 818
DVWA (rs11718863; OS6A) aggctgcctgccattattctt cccatgctgtttcctttgaaca 924
  1. FRZB, frizzled-related protein; MATN3, matrilin 3; aspn, asporin; D, aspartic acid repeat; PTHR2, parathyroid hormone 2; GDF5, growth and differentiation factor 5; DVWA, double von Willebrand A.