Skip to main content

Table 3 Primers and amplification conditions used in the study

From: Investigation of infectious agents associated with arthritis by reverse transcription PCR of bacterial rRNA

Forward primer (5'-3') Reverse primer (5'-3') Specific for Annealing temperature/time MgCl2 concentration (mmol/l) Size of product (bp)
AGTAGTTTACTACTTTGCCG ACTGCTGCCTCCCGTAGGAG Universal (R1 and R2) 58°C/60 secs 1.5 350
CATAACGTCGCAAGACCAAA GTGCAATATTCCCCACTGCT E. coli 58°C/45 secs 1.5 187
TTGGGAATAACGGTTGGAAA TGTCTCAGTCCCAGTGTTGG Chlamydia spp. 59°C/30 secs 1.5 203
CGCACGGGTGAGTAAGGTA GCGTCATAGCCTTGGTAAGC Campylobacter spp. 66°C/1 min 2.5 170
AGTAGTTTACTACTTTGCCG CCGATGGCGTGAGGCCCTAA Yersinia spp. 65°C/30 secs 3.5 154
CGCACGGGTGAGTAAGGTA GCTTAACACAAGTTGACTAG Campylobacterjejuni 63°C/30 secs 2.5 70
CGCACGGGTGAGTAAGGTA GTCTTACATAAGTTAGATA Campylobacter concisus 55°C/30 secs 2.0 70
CGCACGGGTGAGTAAGGTA ATACCTCATACTCCTATTTAAC Bacteroides ureolyticus 55°C/30 secs 2.0 70
  1. Specific oligonucelotides were designed as described here. Standard reaction mix was used with each set of oligonucleotides (see Materials and method), although annealing conditions varied, as did MgCl2 concentration. Denaturation conditions were always 94°C for 1 min and extension was performed at 72°C for 1 min (10 min final extension). Typically 35–40 cycles were performed. If no PCR product was detected, then a second round of amplification was performed using 2 μl of PCR product as template.