Skip to main content

Advertisement

Table 2 lncRNAs and mRNAs for qRT-PCR validation and the primer sequences

From: Aberrantly expressed long noncoding RNAs in human intervertebral disc degeneration: a microarray related study

Gene Sense Sequence 5′ → 3′
lincRNA-SLC20A1-1 F CATCCTCCCACCCAATCATC
  R GGACCTCCAGCAAACACCAG
RP11-296A18.3 F GTTCAAGTGCTTCTCCTG
  R GCTTATGCCTGTAATCCC
KB-1683C8.1 F GGCCAAGGACAAAGAATGGA
  R CATGGGCAGGGAGAAGAGATAG
lincRNA-BTG2 F CCACTACCTCCGCAGCCA
  R GCCCTTCATCCACCCCATA
CASP8 F TTCAGAAGAAGGAGCAG
  R CTGTCCAGTTGTTCC
FAF1 F AGAGCAAAGAGGGAAG
  R AAGAACTCGCCACTG
GAPDH F GGGAAACTGTGGCGTGAT
  R GAGTGGGTGTCGCTGTTGA