Skip to main content

Table 2 Primers for quantitative real-time PCR

From: Down-regulating peroxisome proliferator-activated receptor-gamma coactivator-1beta alleviates the proinflammatory effect of rheumatoid arthritis fibroblast-like synoviocytes through inhibiting extracellular signal-regulated kinase, p38 and nuclear factor-kappaB activation

Name Sense primer (5'-3') Antisense primer (5'-3')
β-actin GGACTTCGAGCAAGAGATGG TGTGTTGGCGTACAGGTCTTTG
IL-6 CTGCGCAGCTTTAAGGAGTTC CAATCTGAGGTGCCCATGCTA
IL-8 GTGCAGAGGGTTGTGGAGAAGTTT TCACTGGCATCTTCACTGATTCTTG
IL-1β CCAGCTACGAATCTCCGACC CATGGCCACAACAACTGACG
TNF-α GCTAAGAGGGAGAGAAGCAACTACA GAAGAGGCTGAGGAACAAGCA
MMP-3 TTTCCAGGGATTGACTCAAAGA AAGTGCCCATATTGTGCCTTC
MMP-13 TCCTGGGCCAAATTATGGAG TTGCCGGTGTAGGTGTAGATAGGAA
RANKL ACCAGCATCAAAATCCCAAG CCCCAAAGTATGTTGCATCC
NF-κB ATGTGGAGATCATTGAGCAGC CCTGGTCCTGTGTAGCCATT
ERK CTACACGCAGTTGCAGTACAT CAGCAGGATCTGGATCTCCC
p38 CCCGAGCGTTACCAGAACC TCGCATGAATGATGGACTGAAAT
  1. MMP: matrix metalloproteinase; RANKL, receptor activator of nuclear factor-kappa B ligand; ERK, extracellular signal-regulated kinase.