Skip to main content

Table 1 Oligonucleotide primers used in cDNA synthesis for the detection of miR-33a and U6 (stem-loop primers) and for real-time quantitative PCR assay a

From: MicroRNA-33a regulates cholesterol synthesis and cholesterol efflux-related genes in osteoarthritic chondrocytes

  RT-qPCR stem-loop primer
miR-33a 5′-TGGATATCCACACCAGGGTCCGAGGTATTCGGTGTGGATATCCATGCAATG
U6 5′-CACGGAAGCCCTCACACCGTGTCGTTC
Gene Forward primer sequence Reverse primer sequence
miR-33a CGCGCGTGCATTGTAGTTG CACCAGGGTCCGAGGT
U6 GCTTCGGCAGCACATATACTAAAAT CTCACACCGTGTCGTTCCA
SREBP2 AAGTCTGGCGTTCTGAGGAA AGGTCCACCTCATTGTCCAC
ABCA1 GGAGGCAATGGCACTGAGGAA CCTGCCTTGTGGCTGGAGTGT
ApoA1 ATGAAAGCTGCGGTGCTGACC CACCTTCTGGCGGTAGAGCTCC
LXRα CCGCCTGAAGAAACTGAA CGAAGCCGGTCAGAAAAG
LXRβ CGCTACAACCACGAGACAGA GTGGAAGTCGTCCTTGCTGT
MMP-13 TGGCATTGCTGACATCATGA GCCAGAGGGCCCATCAA
Smad7 TCCAGATACCCGATGGATTTTC GATTTTGCTCCGCACCTTCT
GAPDH GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG
  1. aABCA1, ATP-binding cassette transporter A1; ApoA1, Apolipoprotein A1; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; LXR, Liver X receptor; miR-33a, MicroRNA-33a mature; MMP-13, Matrix metalloproteinase-13; SREBP2, Sterol regulatory element-binding protein 2.