Skip to main content

Table 1 Primers used for genotyping of wild-type and Tfap2e−/− micea

From: Activating enhancer binding protein 2 epsilon (AP-2ε)-deficient mice exhibit increased matrix metalloproteinase 13 expression and progressive osteoarthritis development

Primer Sequence (5′-3′)
mAP-2ε gen anti2 CTACGTCGCCCTGGACTTCGAGC
mAP2ε gen sense2 TGGAATCCTGTGGCATCCATGAAAC
pGK polyA down GGCTCTCCAGAACATCATCCCTGC
  1. aSequences were obtained from M Moser