Skip to main content

Table 2 Murine primer pairs used for quantitative real-time PCR

From: Activating enhancer binding protein 2 epsilon (AP-2ε)-deficient mice exhibit increased matrix metalloproteinase 13 expression and progressive osteoarthritis development

Gene Primer Product Sequence (5′-3′)
Actb mβ-Act_885for 348 bp TGGAATCCTGTGGCATCCATGAAAC
  mβ-Act_1233rev   TAAAACGCAGCTCAGTAACAGTCCG
Acan mAggrecan_1922for 206 bp CAGTTCACCTTCCAGGAAG
  mAggrecan_2128rev   GTAGAGGTAGACCGTTCTCACG
Col2a1 mColl2_2657for 261 bp CTACTGGAGTGACTGGTCCTAAGG
  mColl2_2918rev   GGACCATCATCTCCAGGTTCTCC
Col10a1 mCol10_38for 287 bp CTGCCCCACGCATCTCCCAG
  mCol10_325rev   GCTTGCCTGGCGGTCCTGAG
Mmp1a/Mmp1b mMMP1_17for 175 bp CTGTTGCTTCTCTGGGCTGC
  mMMP1_192rev   CTGCATTTGCCTCAGCTTTTC
Mmp3 mMMP3_362for 104 bp GTTCCTGATGTTGGTGGCTTCAG
  mMMP3_466rev   CTGTCTTGGCAAATCCGGTGTA
Mmp13 mMMP13_899for 80 bp CCCAGCCCTATCCCTTGATGCCA
  mMMP13_979rev   TGCAGGCGCCAGAAGAATCTGT
Tfap2a mAP-2α_1170for 69 bp GCGGCCCAATCCTATCCT
  mAP-2α_1238rev   CCATGGGAGATGAGGTTGAAG
Tfap2b mAP-2β_1355for 67 bp AAAGCTGTCTCACGCACTTCAGT
  mAP-2β_1421rev   AGCGCAGCGCAAATGG
Tfap2c mAP-2γ_1115for 537 bp ACCTAGCACGGGACTTCGCCT
  mAP-2γ_1651rev   GGGCGGGCGGGTTGTAACTG
Tfap2e mAP-2ε_388for 154 bp GCCGACCCTGGGGAGCTACAC
  mAP-2ε_542rev   CACCTCCGGCGCCGCTTAAA
Timp1 mTIMP1_147for 270 bp AGACACACCAGAGCAGATACC
  mTIMP1_417rev   CCGGATATCTGCGGCATTTC
Timp2 mTIMP2_442for 280 bp GCAGACGTAGTGATCAGAGCC
  mTIMP2_722rev   TCCCAGGGCACAATGAAGTC
Timp3 mTIMP3_255for 315 bp GACCCTTGGCCACTTAGTCC
  mTIMP3_570rev   CGGATCACGATGTCGGAGTTG